mercoledì, Agosto 21

DNA, Musica, Matematica e Fotografia

Google+ Pinterest LinkedIn Tumblr +

Tempo di lettura: 3’. Leggibilità ***.

Douglas Hofstadter, nel suo testo Escher, Bach e Gödel, L’eterna ghirlanda brillante ha intrapreso un cammino per spiegare quale sia la logica delle strutture submolecolari del DNA.

Hofstadter utilizza l’idea di canone cancrizzante, che assume valore essenziale e grande efficacia nell’applicazione al DNA. Nella musica classica, un canone è una composizione contrappuntistica che unisce a una melodia una o più imitazioni, che le si sovrappongono progressivamente. La voce che inizia la melodia viene definita antecedente o dux mentre quella o quelle che seguono conseguenti o comites.

Il dialogo a tre tra Achille, il cui artista preferito è Escher, la Tartaruga il cui artista preferito è Bach e il granchio, il canone cancrizzante appunto che spiega che andare avanti o indietro è la stessa cosa. Hofstadter trae come conclusione che l’eventuale gene del GranChio (GC) è la chiave di lettura.

Tutto può essere schematizzato in questo modo, come struttura del DNA:

TTTTTTTTTGCAAAAAAAAA

AAAAAAAAACGTTTTTTTTT

A è l’Adenina, T è la Timina, ma potrebbero essere anche Achille e Tartaruga. GranChio (Guanina Citosina)

Evidenziazione-Voci-Prima-Fuga-Clav.-ben-Temperato-Bach

Le altezze dei suoni ed i pesi sono tali che le chiavi si possono scambiare iperbolicamente, in modo inversamente proporzionale. Una grandezza cresce l’altra decresce. Il legame tra matematica e musica è forte. Si può parlare di matematica razionale, quella delle frazioni per intenderci.

La somma di frazioni con denominatore differente è soggetta al livellamento del minimo comune multiplo operando algebricamente con opportuni prodotti per l’unità intesa come classe di equivalenza 1=1/1=2/2=3/3… ma che nel gioco dei prodotti al denominatore li rendono uguali e quindi si può applicare il principio che a parità di denominatori si possono, nelle somme, addizionare i numeratori.

Krisztina Turgyei, Budapest

La teoria è molto più semplice di quel che appare e si studia in tutte le scuole medie del mondo.

Al British Museum si trova una tavoletta in cuneiforme Hittita che presenta un esercizio sulle frazioni lasciato da un insegnante ad uno dei suoi studenti. La tavoletta presenta un forte segno sulla argilla molle a tagliare l’esercizio errato. La cosa è divertente. Da piccoli a scuola ci sembra di aver passato soltanto noi le pene dell’inferno, come se un Alessandro Magno o un Tolomeo III d’Egitto non fossero mai stati a scuola… E che scuola…

Immagino Tolomeo III, il nonno del giovane Faraone che fece incidere la stele di Rosetta o di Rashid, in classe a farsi gli scherzetti con Alessandro, a tirarsi palline di creta nei capelli, sghignazzare di una espressione, di un modo di fare di Eratostene, il loro Maestro.

Escher

Sì, ma che c’entra la fotografia? Fotografia è luce, arte di dipingere con la luce. Il primo studioso che si pone come obiettivo la luce è Aristotele con lo studio dell’Arcobaleno.

Secondo il filosofo, l’arcobaleno è un particolare tipo di riflessione della luce del Sole da parte delle nubi. La luce solare viene riflessa secondo un angolo costante e ciò spiega la forma circolare dell’arcobaleno.

Teodorico di Freiberg suggerisce nel 1304 che non è la nube, ma ogni singola goccia a generare l’arcobaleno: un precursore di Huygens.

Insomma si procede a piccoli passi passando per Galilei e Newton fino ad arrivare a Planck: E=hf.

L’energia di un fotone è direttamente proporzionale alla sua frequenza, legata alla lunghezza d’onda, ed è sinonimo di colori.

Ma come fissare su un supporto una immagine? Una superficie fotosensibile è il risultato di fotodegradazione alla luce che per altro non è detto che il termine sia sinonimo di degradazione, ma di cambiamento. Si ossida un sale che diventa più scuro. Si gioca con chimica, fisica e geometria.

Nino Pillitteri – Geraci Siculo, Transumanza 2018 cit La Migrant Mother di Dorothea Lange

E’ possibile convertire immagini e testi in musica e in commercio si trovano svariati applicativi, anche free.

Una cosa semplice che si può fare è cambiare l’estensione di un file .jpg in .wav e riaprire il file con un programma audio. Ascoltate le voste foto, le vostre immagini, sai alle volte, il caso ti potrebbe far uscire un’Aria dalle Variazioni Goldberg.

Share.

About Author

Leave A Reply